Revestimentos de vidro-cerâmica nanoestruturados para aplicações ortopédicas - parte 3


2.2 Força de ligação e microdureza

   A força de ligação elástica entre o revestimento e   substrato   estava   medido   em   conformidade   com   ASTM   C-633-79.   o   testando   procedimento   posso   estar   encontrado   em   nosso trabalho anterior [ 32 ]. Cinco amostras foram testadas indepen-   para   cada   tipo   do   revestimentos   e   a   resultados   foram relatados   Como   média ± sd

A microdureza dos revestimentos foi testada em superfícies de revestimento polido usando um aparelho de microdureza Shimadzu (Shimadzu Co., Japão) com uma carga de 300 gf e   uma   Carregando   Tempo   do   15 s.   Antes   teste,   revestimentos   Foram submetidos   para   bem   polimento.   Dureza   valores   foram gravados   em   15   diferente   posições.  

o   resultados   são apresentados   Como   significar ± sd

 


Tabela 1. Primers utilizados para RT-PCR - marcadores relacionados ao HOB.


gene

seqüência   ( 5 '   - 3 ' )

temperatura de fusão (℃)

GAPDH

F ACCCAGAAGACTGTGGATGG

60


R CAGTGAGCTTCCCGTTCAG


Runx-2

F ATGCTTCATTCGCCTCAC

60


R ACTGCTTGCAGCCTTAAAT


OPN

F TTCCAAGTAAGTCCAACGAAAG

60


R GTGACCAGTTCATCAGATTCAT


colagénio tipo I

F AGGGTCCCAACGAGATCGAGATCCG

60


R TACAGGAAGCAGACAGGGCCAACGTCG


BSP

F ATGGCCTGTGCTTTCTCAATG

60


R GGATAAAAGTAGGCATGCTTG


 


2.3. Testes de liberação iônica e mineralização acelular

     Para medir os comportamentos de liberação de íons dos revestimentos HT e SP, eles foram imersos por 7 dias em uma solução de 15 ml de cloreto de sódio (pH 7,4) tamponada com tris (hidroximetil) aminometano e ácido clorídrico (solução tamponada com HCl-Triis). Após a imersão, os valores de pH da solução tamponada foram medidos e as concentrações de íons foram testadas por espectroscopia de emissão atômica com plasma dirigido por indução (ICP-OES, Optima 3000 DV, USA).

A capacidade dos revestimentos para induzir a precipitação de compostos de Ca e fósforo (P) foi avaliada por imersão de revestimentos em meio de cultura isento de células. Resumidamente, os revestimentos foram esterilizados por imersão em solução de etanol a 70 por cento durante a noite e depois lavados com solução salina tamponada com fosfato (PBS) antes da imersão em meio de cultura. Três mililitros de meio de cultura foram adicionados a cada poço de placa de cultura de 12 poços contendo amostras de revestimento. As amostras de revestimento foram incubadas a 37 em atmosfera húmida de 5 por cento de CO2 durante 5 h, e depois lavadas com água ultrapura, secas e pulverizadas com gás carbónico para observação de SEM. A composição química dos depósitos formados na superfície de revestimento após mineralização foi analisada por espectroscopia de energia dispersiva (EDS), que foi anexada ao instrumento SEM.


2.4. Isolamento e cultura de osteoblastos humanos primários

A permissão para usar tecido humano descartado foi concedida pelo Comitê de Ética Humana da Universidade de Sydney e o consentimento informado foi obtido. Os osteoblastos humanos primários (HOBs) foram isolados do osso trabecular humano normal, como descrito anteriormente [34]. Resumidamente, o osso foi dividido em pedaços de 1 mm3, lavado várias vezes em PBS e digerido com 0,02 por cento (p / v) de tripsina (Sigma -Aldrich, EUA) em PBS, pH 7,4, durante 90 min a 37ºC. As células foram então cultivadas em um meio completo contendo um meio essencial mínimo (a-MEM, Gibco Laboratories, EUA), suplementado com 10 por cento (v / v) de soro fetal de bezerro inactivado pelo calor (FCS, Gibco Laboratories), 2 mM L-glutamina (Gibco Laboratories), tampão Hepes 25 mM (Gibco Laboratories), piruvato de sódio 2 mM, penicilina 30 mg ml -1 , estreptomicina 100 mg ml -1 (Gibco Laboratories) e sal de magnésio fosfato de ácido L-ascórbico 0,1 mM ( Wako Pure Chemicals, Osaka, Japão). As células foram cultivadas a 37 ℃ numa atmosfera de 5 por cento de CO2 e os meios foram atualizados a cada três dias. Após a confluência, as células foram passadas e aquelas na passagem 3 foram utilizadas nas experiências.



2.5. Fixação celular e observação morfológica

Após as células atingirem 80-90% de confluência, foram tripsizadas utilizando TrypLE Express (Invitrogen), subsequentemente centrifugadas e suspensas em meio completo para produzir uma suspensão de células com uma densidade de 3,4 x 104 células por mililitro. Em seguida, adicionou-se 1 ml de suspensão de células a cada poço de uma placa de cultura de células de 24 poços contendo amostras de revestimento. Ap cultura durante 2, 5 e 24 h, as culas foram fixadas numa soluo de paraformaldeo a 4 por cento , p-fixadas usando 1 por cento de tetrido de mio em PBS durante 1 h, depois desidratadas numa soluo de etanol graduada em sie (30, 50, 70, 90, 95 e 100%), e finalmente seco em hexametildisilizano por 3 min. As amostras de revestimento seco foram pulverizadas com ouro antes da observação de SEM.



2.6. Ensaio de proliferação celular

Utilizou-se o ensaio aquoso CellTiter 96 (Promega, EUA), um método colorimétrico, para determinar o número de células viáveis. O ensaio é uma solução combinada de composto de tetrazólio 3- (4,5-dimetiltiazol-2-il) -5- (3- carboximetoxifenil) -2- (4-sulfofenil-2H-tetrazólio) (MTS) e um reagente de acoplamento de elétrons (metosulfato de fenazina) com uma raz� em volume de 20: 1. O composto anterior pode ser bio-redu�o por c�ulas vi�eis num formazano, que �sol�el em meio de cultura de c�ulas. Assim, a absorbância do formazan a 490 nm é diretamente proporcional ao número de células viáveis. Quatro amostras de cada tipo de revestimento foram testadas para cada ponto de tempo e os discos Ti-6Al-4V não revestidos foram usados como controle. Resumidamente, 1 ml de suspensão de células com uma densidade celular de 8,5 x 104 células ml -1 foi adicionado a cada poço de uma placa de cultura de 24 poços contendo as amostras de revestimento. Ap 3 e 7 dias, o meio de cultura foi substituo por 700 da soluo de trabalho MTS que era uma soluo cinco vezes dilua do Ensaio Aquoso CellTiter 96 em PBS. Após 4 h de incubação adicional, 100 ml da solução de trabalho foram transferidos para uma placa de cultura de células de 96 poços para medir a absorvância usando um leitor de microplacas (PathTech) a 490 nm.


2.7. Reação em cadeia da polimerase quantitativa em tempo real

Os HOBs foram semeados nas amostras de revestimento a uma densidade celular de 2 x 104 células cm -2 e cultivados durante 1 dia e 7 dias. Após cada ponto de tempo, isolou-se o ARN total de HOBs cultivados em amostras de revestimento e as amostras de controlo de discos de Ti-6Al-4V não revestidos utilizando Trizol (Sigma) seguindo as instruções do fabricante. O ADNc de primeira cadeia foi sintetizado a partir de 0,7 g de ARN total utilizando o kit Omniscript RT (Qiagen, EUA) de acordo com as instrues do fabricante. O cDNA foi então analisado por PCR em tempo real (Rotor-Gene 6000, Corbett Life Science) para os genes relacionados a osteoblastos: Runx-2, colágeno tipo I, osteopontina (OPN) e sialoproteína óssea (BSP) e sua expressão gênica relativa os níveis foram obtidos por normalização com gliceraldeído 3-fosfato desidrogenase (GAPDH).

Primers utilizados para os genes selecionados estão listados na tabela 1.


2.8. Análise estatística

Os dados foram obtidos de quatro experimentos independentes e expressos em média ± dp. Para análise estatística , foi utilizado o programa SPSS 17.0. O teste de Levene foi realizado para determinar a homogeneidade da variância para todos os dados e, em seguida, os testes post hoc de Tukey HSD foram utilizados para os dados com variância homogênea, caso contrário, foi empregado o post hoc de T2 de Tamhane.

Um valor de p inferior a 0,05 foi considerado significativo.



******continua******